Abstract
In this article, the bottom right panel of Fig. 4a is labeled “TALEsp2 stabilized” and the dashed blue curve in the bottom left panel is identified as the geometric mean of the TALEsp2 stabilized induction curves. In both cases, TALEsp2 should have read TALEsp1. In the Supplementary Information originally posted for this article, the RBSsp2 sequence in Supplementary Table 3 was shown as ATCAATTCATCGACGTGAAA; the correct sequence is ATCAATTCATCGATGTGAAA. This sequence was incorporated into that of the TALEsp2 stabilized promoter used in plasmids pTHSSe_60 and pTHSSf_27-38, 40, 98, and the genomic insertion of pTHSSf_40. The revised Supplementary Information is available in this notice.
| Original language | English (US) |
|---|---|
| Pages (from-to) | 799 |
| Number of pages | 1 |
| Journal | Nature Biotechnology |
| Volume | 40 |
| Issue number | 5 |
| DOIs |
|
| State | Published - May 2022 |
ASJC Scopus subject areas
- Biotechnology
- Bioengineering
- Applied Microbiology and Biotechnology
- Molecular Medicine
- Biomedical Engineering
Fingerprint
Dive into the research topics of 'Author Correction: Engineered promoters enable constant gene expression at any copy number in bacteria'. Together they form a unique fingerprint.Cite this
- APA
- Standard
- Harvard
- Vancouver
- Author
- BIBTEX
- RIS